Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Dpp4 - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Dpp4 EntrezGene ID: 13482
Gene Name: dipeptidylpeptidase 4
Alternate Names: Cd26, Dpp-4, THAM
Related data:
From the Allen Brain Atlas: Dpp4
Expression Info
       

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_010074 Transcript Version: 2 Transcript GI: 31981797
Riboprobe
Orientation: Antisense Riboprobe ID: RP_071213_02_H06
Forward Primer: GGCTGGGTCGGAAGATTT Reverse Primer: TCGCTTGCTGTCCACAAA

Sequence:
GGCTGGGTCGGAAGATTTAGGCCCGCAGAACCTCACTTCACCTCTGATGGAAGCAGCTTCTATAAGATCATCAGCGACAA
AGATGGCTATAAACACATCTGCCACTTCCCGAAAGATAAGAAAGACTGTACATTTATTACAAAAGGAGCCTGGGAAGTCA
TTAGTATCGAAGCTCTGACCAGCGATTATCTATACTACATTAGTAACCAATATAAAGAAATGCCAGGAGGAAGAAATCTC
TATAAAATTCAACTTACTGACCACACAAATGTGAAGTGCCTTAGTTGTGACCTGAATCCAGAAAGATGTCAGTATTATGC
AGTATCATTTAGTAAAGAGGCAAAGTACTATCAGCTGGGATGTTGGGGCCCCGGTCTGCCCCTCTACACTCTACATCGTA
GCACGGATCATAAAGAGCTGCGAGTCCTGGAAGACAATTCTGCTTTGGATAGAATGCTGCAGGATGTCCAGATGCCTTCA
AAAAAATTGGACTTCATTGTTTTGAATGAAACAAGATTTTGGTATCAAATGATCTTGCCCCCTCATTTTGATAAATCCAA
GAAATATCCTCTACTATTAGATGTATATGCAGGTCCCTGTAGTCAAAAAGCAGATGCTTCCTTCAGACTGAACTGGGCCA
CTTACCTTGCAAGTACAGAAAACATCATAGTAGCTAGCTTTGACGGCAGAGGAAGTGGTTACCAAGGAGATAAGATCATG
CATGCAATCAACAGAAGATTGGGAACACTGGAAGTTGAAGATCAAATTGAAGCAGCGAGGCAATTTGTAAAAATGGGATT
TGTGGACAGCAAGCG
External Resources for Dpp4
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.