Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Pmpca - Juvenile M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 4.0 days Treatment Type: ISH
Gene
Gene Symbol: Pmpca EntrezGene ID: 66865
Gene Name: peptidase (mitochondrial processing) alpha
Alternate Names: 1200002L24Rik, 4933435E07Rik, Alpha-MPP, P-55
Related data:
From the Allen Brain Atlas: Pmpca
Expression Info

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_173180 Transcript Version: 2 Transcript GI: 31343347
Riboprobe
Orientation: Antisense Riboprobe ID: RP_071217_04_E01
Forward Primer: GCCACTGCTCACCGAGAT Reverse Primer: CGGTATGATCTGGGCAGG

Sequence:
GCCACTGCTCACCGAGATGATTCATGAAGCTGCTTTTAGGGAGAACACAGTGGGTCTGCACCGGTTCTGCCCTGTAGAGA
ACATAGCGAAGATCGATCGGGAAGTGCTGCACTCCTACCTAAAGAACTACTACACCCCTGACCGCATGGTGCTTGCTGGG
GTGGGCGTGGAGCATGAGCACCTAGTAGAATGTGCCAGAAAGTACCTCGTGGGAGCCGAGCCTGCCTGGGGAGCCCCTGG
AACGGTGGACGTTGACAGATCAGTGGCACAGTACACTGGGGGGATCATCAAGGTGGAAAGAGACATGTCAAATGTCAGCC
TTGGCCCAACCCCAATTCCAGAGCTCACACACATCATGGTGGGACTGGAGAGCTGTTCCTTCCTGGAGGACGACTTCATC
CCCTTTGCTGTGCTGAATATGATGATGGGAGGAGGGGGCTCCTTCTCAGCTGGAGGGCCTGGCAAAGGCATGTTCTCCAG
GCTCTACCTCAATGTGCTCAATCGGCACCACTGGATGTACAATGCAACCTCCTACCACCACAGCTATGAAGATACAGGCC
TCCTGTGCATTCATGCCAGCGCAGACCCAAGACAAGTTCGAGAAATGGTAGAAATCATCACAAAGGAGTTTATCTTGATG
GGCAGGACGGTGGATTTGGTGGAGCTAGAGCGGGCCAAGACACAGCTCATGTCCATGCTCATGATGAACCTGGAGTCCAG
GCCTGTGATTTTTGAGGATGTGGGGAGGCAGGTGTTGGCTACACATTCAAGAAAGCTGCCCCACGAGCTATGTACACTCA
TTCGCAACGTGAAGCCAGAAGATATCAAGAGGGTTGCTTCCAAGATGCTCCGTGGCAAGCCTGCTGTGGCTGCCCTGGGT
GATTTGACTGACCTACCCACCTATGAGCACATCCAGGCAGCGCTGTCCAGCAGAAATGGACACCTGCCCAGATCATACC
External Resources for Pmpca
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.