Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Mrps18c - Juvenile M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 4.0 days Treatment Type: ISH
Gene
Gene Symbol: Mrps18c EntrezGene ID: 68735
Gene Name: mitochondrial ribosomal protein S18C
Alternate Names: 1110037D14Rik
Related data:
From the Allen Brain Atlas: Mrps18c
Expression Info
         

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: XM_194230 Transcript Version: 4 Transcript GI: 51711104
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080102_02_C09
Forward Primer: CCGCTCTGGTTGCTCTGT Reverse Primer: TTGGCAGGAACTTCACAAA

Sequence:
CCGCTCTGGTTGCTCTGTGCAGTGGTATAGGGAGGAAGAATTTGACAACCGCGGCTGGCTGCTTCACGGATCGCGGAACT
CAAGCAGTTTCTGTGATTTGGAGACGATGTTTTTCACAGTTTGAACAGGTAACCAGCAATGAGGACCTGCCAGTCCCAAT
GGAGAACCCCTACAAGGAGCCTCTTAAGAAGTGTGTCTTGTGTGAGAAACGTGTAGATTACAAGAATGTGCAGCTTTTGT
CCCAGTTTATTTCTCCATTTACCGGATGCATTTATGGAAGGCACATAACAGGTCTTTGTGGAAAGAAACAGAGGGAAATA
ACTAAAGCCATTAAGAGAGCTCAGAAAATGGGGTTTATGCCAGTTACATACAAGGATCCTGCATATCTCAAAGACCCTAG
AGTTTGTAACATCAGATACCGAGAATAAATTTTGTATTTGTGAAGTTCCTGCCA
External Resources for Mrps18c
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.