Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Tesk2 - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Tesk2 EntrezGene ID: 230661
Gene Name: testis-specific kinase 2
Alternate Names: MGC29168
Related data:
From the Allen Brain Atlas: Tesk2
Expression Info

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_146151 Transcript Version: 2 Transcript GI: 31981901
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080107_02_A07
Forward Primer: GACCCAGGCTTAAGGGGA Reverse Primer: CGCGGCTCTTTAAGGACA

Sequence:
GACCCAGGCTTAAGGGGACCAGCCTATGCACTGGGGCTGCCTCTGAGGAGATGGAGGTGGAAGAGGAAAGGCCACGAAGA
GCTTCTGTCTACTTCTCTATCTCTGGAATAAGCTTGCAAACCCAGGCAAAGCAGGATGGGTGAGATGGGGGCAGGACTAG
TCCCTGCCTGCCATATGAGAGGCGTTTCAGTAGTTAGGGCCAACCTAATTTTAAGCCTCTGAAATCCAGCAAGGAGGTTT
GGTTCCCATGGACCACAGTGCACGTCCTAGACAGGACCAAAAAACTCTTCGTGCTAGGCTGGGCTGGCAGGTACCATGTA
CCAGTCCCTTTCCTACTCTTAAGTCTCTCATGCCGATTCTGGGGCATGTAAGCTACAGGATGGAAACTGGAGTTGGCAGG
AGGCCGCTAGGGTGTGGCTGTTTCTTAGACATGACGACTGGGATGCCTCTTGCCAGTGTGTCTCAGACACTTGAATAATT
GCGGTTTGCACTTACTGTATGTCAGACCACATCACTACATCTCTATGCAAGGGGGACAAGGCAATGTGGTGGTCGAGGAT
CTTTTAGCTAACCTAGTCAAAGACTTTTCCAGTTGATTAATCTATTTTCATATTTATAAAGGAGTCTTAATGTTTTGCCT
CAAGACTTTCAACCTTGGCGTTGGGAGTGGGGCTGGTATTGTAGGCCCTAGGGCCTGCTCTATGTATGTGTCAACAGGTG
ATACAACCCTTTAGTTAATGGTTTATACTTGGACTGATTTTCTTTCCTCCTGTAGCTGGAGCTTTGGGAACAGTCTGTCC
TTAAAGAGCCGC
External Resources for Tesk2
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.