Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Minpp1 - Juvenile M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 4.0 days Treatment Type: ISH
Gene
Gene Symbol: Minpp1 EntrezGene ID: 17330
Gene Name: multiple inositol polyphosphate histidine phosphatase 1
Alternate Names: AA408516
Related data:
From the Allen Brain Atlas: Minpp1
Expression Info
 

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_010799 Transcript Version: 1 Transcript GI: 6754697
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080107_03_A12
Forward Primer: CGTAGAGCAATAAAGCCTGG Reverse Primer: TAAATTCGGCAGATGAGGTC

Sequence:
CGTAGAGCAATAAAGCCTGGTCTTTCTGTCTTTTCACAGAAAATAATAGTTCCTTTTAAGATCTGGACATACGGGTAAGA
CATGACTCTCCCTGGAGCAGCTCTCTGCAGAACAAAAACTAATTCAACGAAGCAGCTGTCCCTCCCAGTGTTTGCAGAGC
TGAGATTTTCCTAATGACCTAAGAAGATACTGACGTAGAACGGTATTAGAAAGTGACACTTCAAAAATGTTGGATACCAA
AGCACGGTAGCTGCCGGGTGAGCGGCAGTGATTGGCAGAGATGGGGACTTGAGTGACCGTGTTGGGTTCCCTCCTTCTCC
TTCTTGCAGGGCACAAATGATATCGCTTAGTCATAAGTGTGGTAGACTGGATCCTGACCAGAAGGAGGTCTGATATATCC
ATCCAGACAGGAAATCGACATGCTACCAAGAACCAGGTTGAAGCAAAACTGAAAGTGTGGGATATTTTTGTTGACGTTAT
TTATAAAAATATTTCAACACTGTCAATGATTGCCTTTAACCTCCAAGTAGGTCTTGCAGAATCGTCTTCATTTCATCAGA
CCTGTTGGGGGTGAACAGTAATAATAGGAGGCCCAGCCTGGCAGATGCTTGCTGACGCTCCTTGGCTCTTGCCTGCTTGT
CTTTTTCATTCCATCATGGCTTCCCTTTTCATAGCTGGATCTTCCATGAAGTGTTCCTTTTGGTGGTTTGGATTTTTTTT
TTTTAAATAAAGACCTCATCTGCCGAATTT
External Resources for Minpp1
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.