Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Smpdl3b - Juvenile M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 4.0 days Treatment Type: ISH
Gene
Gene Symbol: Smpdl3b EntrezGene ID: 100340
Gene Name: sphingomyelin phosphodiesterase, acid-like 3B
Alternate Names: 1110054A24Rik, Asml3b, AU045240
Related data:
From the Allen Brain Atlas: Smpdl3b
Expression Info
       

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_133888 Transcript Version: 1 Transcript GI: 19527103
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080205_02_G09
Forward Primer: GCTGTGCTGGCAATTGTG Reverse Primer: GCACAAACGTGCTCGATG

Sequence:
GCTGTGCTGGCAATTGTGGAACGCTTGACCAACCTCATCAAGGAAGTCTTTCCAGACACTAAAGTCTATGCTGCTCTGGG
AAATCATGACTTCCACCCTAAGAACCAGTTCCCAGCACAGAGCAACCGCATCTATAACCAGGTGGCAGAGCTGTGGAGAC
CCTGGCTTAGTAACGAATCCTACGCTCTCTTCAAAAGAGGTGCCTTCTATTCTGAGAAGTTGCCGGGTCCCAGCAGGGCG
GGGCGAGTTGTGGTCCTCAACACCAATCTGTACTACAGCAACAACGAGCAGACAGCTGGCATGGCTGACCCCGGCGAGCA
GTTCCGGTGGCTGGGAGATGTCCTGAGCAATGCATCTCGGGATGGGGAGATGGTGTATGTTATTGGCCACGTGCCCCCGG
GGTTCTTTGAGAAGACACAGAACAAGGCCTGGTTCCGAGAGAGCTTCAATGAGGAGTATCTGAAGGTGATCCAGAAGCAC
CATCGGGTCATAGCGGGGCAGTTCTTTGGACACCACCATACCGACAGCTTCCGAATGTTCTATGACAACACAGGTGCCCC
CATAAACGTCATGTTTCTCACACCCGGGGTCACACCGTGGAAGACCACATTACCTGGAGTGGTCGATGGGGCCAACAATC
CAGGGATACGCATTTTCGAGTATGATCGAGCCACACTCAACTTGAAGGACTTGGTGACTTACTTCTTGAACCTGAGGCAG
GCGAATGTACAAGAGACCCCACGGTGGGAGCAGGAGTACCGCCTGACGGAGGCCTACCAGGTGCCGGATGCCAGCGTCAG
CTCCATGCACACGGCGCTGACCCGCATTGCCAGTGAGCCTCACATCCTGCAACGTTATTACGTCTATAACTCGGTCAGCT
ACAACCATTTGACCTGTGAGGACAGCTGCCGCATCGAGCACGTTTGTG
External Resources for Smpdl3b
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.