Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - 2610307O08Rik - Juvenile M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 4.0 days Treatment Type: ISH
Gene
Gene Symbol: 2610307O08Rik EntrezGene ID: 72512
Gene Name: RIKEN cDNA 2610307O08 gene
Alternate Names:
Related data:
From the Allen Brain Atlas: 2610307O08Rik
Expression Info
       

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: XM_128954 Transcript Version: 4 Transcript GI: 51770838
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080215_02_A12
Forward Primer: CATGCTCAGTGGTGCAGG Reverse Primer: TGACCAGAAGCTGGAGGG

Sequence:
CATGCTCAGTGGTGCAGGGAGCCGAAGACTGTACATCCTCTTTCCATTGGACTGTGGGGTGCCTGACAACCTGAGTGTAG
TTGACCCCAACATTCGATTCCGAGATATGCTGCCCCAGCAAAACATCGACCGTGCTGGCATCAAGAATCGGGTTTATTCC
AACAGCGTCTACGAGATTCTGGAGAACGGACAGCCAGCAGGCGTCTGTATCCTGGAGTACGCCACCCCCTTGCAGACCCT
GTTTGCCATGTCACAGGATGCCAAAGCTGGCTTCAGTCGGGAGGATCGGCTTGAGCAGGCTAAACTCTTCTGCCGGACAC
TTGAGGAAATCCTGGAAGATGTCCCCGAGTCTCGAAATAACTGCCGCCTCATTGTCTACCAAGAACCCACAGACGGAAAC
AGTTTCTCACTGTCTCAGGAGGTGCTCCGGCACATTCGTCAGGAAGAAAAGGAGGAGGTTACCATGAATGCCCCCATGAC
CTCAGTGGCACCTCCTCCCTCCGTACTGTCCCAAGAGCCAAGACTCCTCATCAGTGGTATGGATCAGCCTCTCCCACTCC
GCACTGACCTCATCTGAGGCATGGGACAGCCTTGTCTGGGCTCTAGTGATCCTTTAGCCTCCTGACTGAGCCTTCCTTCA
ATGGTTGGGGGCCTCAGAGACTTCACATCTCCAGATGAGTCCCACATTCCTGGGCAAGCCATTTATTTCACCTCTCTGAG
CCTCAACCAACCCTACTATGAAAGGAGGTCATAATGCGTTCCCTGCCCAGCCAAAGGATTTTATATATGTAGAAGTTGGT
GTCAATGCCTGGTAAACTTGAGAGAAAGGCCAAGTACTTCCCGTGGATGCTGCAGACATTCCCTGCTCTCTGTTGACCTG
TGTGGATGGTACCAGCAGACTTCCAACCCTCCAGCTTCTGGTC
External Resources for 2610307O08Rik
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.