Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Dmrt1 - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Dmrt1 EntrezGene ID: 50796
Gene Name: doublesex and mab-3 related transcription factor 1
Alternate Names:
Related data:
From the Allen Brain Atlas: Dmrt1
Expression Info
   

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_015826 Transcript Version: 2 Transcript GI: 40254565
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080228_03_F05
Forward Primer: ACTACAGCAGCTTTTACCAGCC Reverse Primer: GTGAGCCAGGCACTTACTTCTT

Sequence:
ACTACAGCAGCTTTTACCAGCCTTCTCTGTTTCCTTACTACAACAATCTGTACAACTACCCCCAGTATTCCATGGCCTTG
TCTGCTGAGTCCTCCTCAGGGGAGGTGGGGAATTCCCTCGGGGGATCCCCCGTGAAGAACAGCCTGCGGAGTCTCCCAGC
ACCTTACGTGCCTGCTCAGACTGGAAACCAGTGGCAGATGAAGACCTCAGAGAGCCGCCACCCAGTGAGCTCCCAGTACC
GGATGCACTCATACTACGGGCCTCCCTCCTACCTGGGCCAGAGCATGTCCCAGATCTTTACCTTCGAGGAAGGCCCCTCC
TACTCAGAAGCCAAAGCCAGTGTGTTCTCGCCCCCCAGCAGTCAAGATTCTGGCTTGGTCTCCCTCTCCAGCAGCTCTCC
GATGAGCAACGAGAGCTCGAAGGGAGTTCTGGAATGTGAGTCTGCGTCCTCGGAACCTAGCAGCTACGCCGTCAACCAGG
TCCTGGAAGAGGATGAGGACGAGTGAGCCGCCGCCGGGGCTACTCTGGCTTGTTTTGTTATCGGCAGGGTTTGTTGTTAT
TTGAATTGGCAGTGCTGGCTGCCCATTCAGAAGTTTGGTTCATGTTAGAGTTAGGTTAAAACACTTGTAACAGTGTAGGA
TCCCAGACTACCATCTGCAAGAAGTAAGTGCCTGGCTCA
External Resources for Dmrt1
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.