Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - BC067074 - Juvenile M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 4.0 days Treatment Type: ISH
Gene
Gene Symbol: BC067074 EntrezGene ID: 408066
Gene Name: cDNA sequence BC067074
Alternate Names:
Related data:
From the Allen Brain Atlas: BC067074
Expression Info
             

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: XM_484321 Transcript Version: 1 Transcript GI: 51767917
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080310_02_C05
Forward Primer: CTCCTTCACCTTCTTGCTCAGT Reverse Primer: GATCATAGGATTGGGTCTGGAA

Sequence:
CTCCTTCACCTTCTTGCTCAGTGCAGACCATGTGCAGCCAGCAGCAGGTTATCTAGCCTTTACCATAGTGCCACCAGACC
CCTTACCTTTACAGACATTTACACCAGATGTGCCTTTATTTGTCACTGGAGAGACCCTCGTGGCCTCTGTTTCCTCTCAG
AAAAAACTTAGGGCTTCTATTAAAAAACAGACAGAAACTCCGGGGAATCTGACCCAGGGCAGATGGCAGGGGACAGATTC
CTGGGGTCAACTCAGTGGCAAAGAGCCAAATATAGATGCCAAGGTCTCTCCCACCAGGGTCATTTGGCCATATGCTGCCA
CCAAAGTGGGGGAGTCCCTTTCCGGGGGAGCCATGCAGCCGGAAATGAGCCGTCACCCTCTGGTGGTCATCATACCTTTG
GCTGCTGTGTTCCTCCTCCTGCTGGTGACTGTGGTGGCCCTGTGTGTTTGGCTACTGAGCCGAAAGGAGGACAAACCCAA
ACCACTTACCCAGCCAAAGACAAACCTGAAGTCCCCATCCACAGGCTCTAGAGCAGAGAGGAGTGGAGCCATTCCCACGG
TCACGGTGACACCCCTTATTAGAAGCAGCCTGGCTCCTAGTCTGTTCCAGACCCAATCCTATGAT
External Resources for BC067074
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.