Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Eif3s10 - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Eif3s10 EntrezGene ID: 13669
Gene Name: eukaryotic translation initiation factor 3, subunit 10 (theta)
Alternate Names: A830012B05Rik, Csma, Eif3, mKIAA0139
Related data:
From the Allen Brain Atlas: Eif3s10
Expression Info

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_010123 Transcript Version: 2 Transcript GI: 46575902
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080312_03_G01
Forward Primer: GTTCCTAGAAGGGGTGATGATG Reverse Primer: CCCTATCTTTCTCAGCTCTCCA

Sequence:
GTTCCTAGAAGGGGTGATGATGCAAGACCTGGTCCTTGGAGACCATTTGTCAAGCCAGGTGGATGGAGAGAGAAAGAAAA
GGCTAGAGAAGAGAGTTGGGGTCCACCTCGAGAATCAAGACCATCAGAAGAACGTGAATGGGATAGAGACAAAGAGAAGG
ACAGAGATAATCAAGATCGAGAGGAGAATGACAAAGACCTTGAACGAGATAGGGACAGAGAGAGAGATGGGGACCGGGAG
GATCGATTCAGAAGACCCAGGGATGAAGGTGGCTGGAGAAGAGGACCAGCAGAAGAATCTTCAAGCTGGAGAGATTCAAG
TCGCCGTGATGATAGGGACAGGGAAGACCGTCGACGGGATAGAGATGATCGTCGTGATCTGAGAGACCTGAGAGACAGAA
GGGATTTAAGAGATGATAGAGATCGGAGAGGACCTCCCCTCAGATCAGAGCGAGAAGAAGCAAGCTCTTGGAGACGCACT
GATGACAGGAAAGATGACCGGACTGAAGAGAGGGATCCACCTCGTCGTGTTCCTCCCCCAGCTCTTTCAAGAGATCGAGA
AAGAGAGCGAGAACGAGAAGGTGAGAAAGAGAAAGCATCCTGGAGAGCTGAGAAAGATAGG
External Resources for Eif3s10
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.