Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Fgf18 - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Fgf18 EntrezGene ID: 14172
Gene Name: fibroblast growth factor 18
Alternate Names: D130055P09Rik, FGF-18
Related data:
From the Allen Brain Atlas: Fgf18
Expression Info
 

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_008005 Transcript Version: 1 Transcript GI: 6679780
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080312_04_E10
Forward Primer: CTTTCTACTGCTGTGCTTCCAG Reverse Primer: TCACCTCCTAGAGAGAGGCAAG

Sequence:
CTTTCTACTGCTGTGCTTCCAGGTTCAGGTGTTGGCAGCCGAGGAGAATGTGGACTTCCGCATCCACGTGGAGAACCAGA
CGCGGGCTCGAGATGATGTGAGTCGGAAGCAGCTGCGCTTGTACCAGCTCTATAGCAGGACCAGTGGGAAGCACATTCAA
GTCCTGGGCCGTAGGATCAGTGCCCGTGGCGAGGACGGGGACAAGTATGCCCAGCTCCTAGTGGAGACAGATACCTTCGG
GAGTCAAGTCCGGATCAAGGGCAAGGAGACAGAATTCTACCTGTGTATGAACCGAAAAGGCAAGCTCGTGGGGAAGCCTG
ATGGTACTAGCAAGGAGTGCGTGTTCATTGAGAAGGTTCTGGAAAACAACTACACGGCCCTGATGTCTGCCAAGTACTCT
GGTTGGTATGTGGGCTTCACCAAGAAGGGGCGGCCTCGCAAGGGTCCCAAGACCCGCGAGAACCAGCAAGATGTACACTT
CATGAAGCGTTACCCCAAGGGACAGGCCGAGCTGCAGAAGCCCTTCAAATACACCACAGTCACCAAGCGATCCCGGCGGA
TCCGCCCCACTCACCCCGGCTAGGTCCGGCCACACTCACCCCCCCAGAGAACTACATCAGAGGAATATTTTTACATGAAA
AATAAGGAAGAATCTCTATTTTTGTACATTGTGTTTAAAAGAAGACAAAAACTGAACCTAAAGTCTTGGGAGGAGGGGCG
ATAGGATTCCACTGTTGACCTGAACCCCATGACAAAGGACTCACACAAGGGGACCGCTGTCAACCCACAGGTGCTTGCCT
CTCTCTAGGAGGTG
External Resources for Fgf18
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.