Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Dnajc13 - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Dnajc13 EntrezGene ID: 235567
Gene Name: DnaJ (Hsp40) homolog, subfamily C, member 13
Alternate Names: D030002L11Rik, Gm1124, KIAA0678, mKIAA0678, Rme8, RME-8
Related data:
From the Allen Brain Atlas: Dnajc13
Expression Info
         

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: XM_135146 Transcript Version: 5 Transcript GI: 51765090
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080312_02_H10
Forward Primer: GAAGTTGCCTGAAGACTTTGCT Reverse Primer: GGATTTCACTCACCTGTTCTCC

Sequence:
GAAGTTGCCTGAAGACTTTGCTGTGGTGTTCGGAGAAGCAGAGGGGGAGCTTGCTGTTGGAGGCGTTTTCTTGAGGATCT
TTATTGCACAGCCAGCTTGGGTGCTGAGGAAACCCAGAGAATTTCTTATTGCACTGCTAGAAAAATTAACTGAGCTCCTG
GAGAAGAACAATCCACATGGAGAAACTCTGGAAACACTGACCATGGCGACGGTCTGTCTCTTCAGTGCACAGCCTCAGTT
GGCAGATCAAGTCCCGCCATTGGGCCATCTTCCCAAAGTTATCCAGGCGATGAATCACAGAAACAATGCCATTCCTAAGA
GTGCAATTCGGGTTATTCACGTCCTGTCTGACAATGAGCTGTGTGTCCGAGCCATGGCGTCCTTGGAGACCATTGGCCCA
CTGATGAATGGAATGCGAAAGCGAGCAGATACTGTGGGCCTGGCCTGTGAAGCCATCAACCGCATGTTCCAGAAGGAGCA
GAGTGAGCTGGTAGCGCAGGCATTGAAAGCAGAGTTGGTCCCATACCTCTTAAAGCTGCTTGAAGGCGTAGGCCTTGAAA
ACCTCGACAGTCCTGCTGCCACCAAGGCCCAGATTGTCAAAGCTCTTAAGGCAATGACTCGAAGTCTGCAGTATGGAGAA
CAGGTGAGTGAAATC
External Resources for Dnajc13
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.