Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Khsrp - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Khsrp EntrezGene ID: 16549
Gene Name: KH-type splicing regulatory protein
Alternate Names: 6330409F21Rik, KSRP
Related data:
Expression Info
 

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_010613 Transcript Version: 2 Transcript GI: 51492006
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080313_03_E01
Forward Primer: AGGCTGCTTACTACGGACAGAC Reverse Primer: CTGGCTACAGGAGGCTACAACT

Sequence:
AGGCTGCTTACTACGGACAGACCCCAGGCCCTGGTGGCCCACAGCCACCTCCCACCCAGCAGGGACAGCAGCAGGCAAGT
GGGAACTGCCACCCTCCTCCTCCTCCTTTCTCCTTCCAACCCCCGGCCACCGTCCATCCTGCCTTAGTGGGTAGCGCCGG
AAACCCTTTCCCCTGCGGGGTGTGCCCTTGATGCCAGCCTCGGGCTCGTGGCCAGAGTCTCCCAGAGCCTCGCAGCCCCG
CCGCTGGGAAGCGCTCGATGGGTGCAGAGGCTTACGGAAGAGGCTCCTCCAGTAGCCACTGTCGTGCGACGTTGTCGGGT
GCTGGGGGCACCGGCCGCAAAGGTGGAACTCTGAACTGCTGGGGTGTCCCGGGTGGGGGCAGGATGTGGGGACTGTGCTG
GGTGCCACACCGGTTGCTGAACCTGCTCGCTCAAAATCTGGCCACTTGGGAAGAAAATGTCTATTTTTTTCCCCCTTCTC
AGCATCACTATTTTGGGTTTTGTTCTTTTTTTATTCTTTTTTCATGTCCAAGTAACTGTGTGTTGCAGGCGGCCCTGGCT
CTGCTGGGATGAAGGGGAGCCCACTGAGGGGACTGGGCCCTCCCTGCCTGGCAAGGCCATCTCTTGTGTGCTTGCCTCTG
TGTCCCGGTCTTGTCTGTGAAGTGGGCATGACGATCGTTGCCACCTTCCAACCTACCTCACAGGGGTGTTGTGGGGACAC
CATGATCTGAATGTTGTGACGCCGAGCTGCCGCCTCCCTCCTCTGTCCCCCTCCCCCCTGGCAACTTCTCCCCTGTGTGC
CCTCTTCCACACCTCTGGCTTCTGCTGCAGACTTCTCCTCCTCTTCCTCTTCCTCCTGCTTCTCCTCCACCAAGGAGCAG
TCTGGCCAGTGGAGTCCCCAAGACAGACAGTCACGGCCCCCTGCTTAGCCTGTGGGGGCTTGGGCCCGGCCTCTTGGCCC
ACTGCCTGGAGTTGTAGCCTCCTGTAGCCA
External Resources for Khsrp
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.