Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Svp2 - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Svp2 EntrezGene ID: 20941
Gene Name: seminal vesicle protein 2
Alternate Names: Svp-2, SVS-IV
Related data:
From the Allen Brain Atlas: Svp2
Expression Info
     

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_009300 Transcript Version: 1 Transcript GI: 33468868
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080324_01_D07
Forward Primer: TTTTCTCTGCTTCTCCTTCTGG Reverse Primer: AAGACATCATGGGCTCTGTTCT

Sequence:
TTTTCTCTGCTTCTCCTTCTGGTGACAGGAGCCATTGGGAAGAAAACTAAGGAAAAATTCTTGCAGTCGGAAGAAACTGT
CAGAGAGAGCTTCTCGATGGGAAGCAGAGGCCATATGTCAAGAAGTTCTGAGCCAGAGGTATTTGTTAGGCCACAGGACT
CCATCGGTGACGAAGCTTCTGAGGAAATGAGTAGTAGTAGTAGTAGTAGAAGAAGAAGTAAGATTATCTCTAGCAGTTCT
GATGGTTCTAATATGGAAGGTGAGAGTTCATATTCAAAGAGAAAGAAGAGCCGGTTTTCTCAAGATGCACTCGAGTGATA
CTGCATTGACCAGCTGAACATCTGGACCAATATGCTGGAGCCATATCGCCAGAACAGAGCCCATGATGTCT
External Resources for Svp2
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.