Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - 4931406P16Rik - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: 4931406P16Rik EntrezGene ID: 233103
Gene Name: RIKEN cDNA 4931406P16 gene
Alternate Names: AA553327, mKIAA0355
Related data:
From the Allen Brain Atlas: 4931406P16Rik
Expression Info
       

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_172741 Transcript Version: 1 Transcript GI: 27370083
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080326_02_C10
Forward Primer: CATGTAATGTACAAGAGCGGGA Reverse Primer: AGTACTAAAAACGCAGGTGGCT

Sequence:
CATGTAATGTACAAGAGCGGGATTGGGCAACTGCTGTCAGGCATATTCTGGCCTCCCAGGGGGTGCAGCTGGTGCATGCT
GAGTGCACCTGCTGCCCTCACTTCCTTCCACCATGACCAGGGCAGCACCAGCACCACGCTCCTCTACGGAAGGAACTGTG
GAGGGGAGGGGTTGCACCAAGACCCCCACACTCAGAACCACAGTGACATTGTGAGCTGACTCAGAGACAAAGGAATTATG
ATGTAGACAGGAATTCAAAATCTTTGTTTAGTCACCAACAACACCTCACTTTTAGTTAATGTGTGCCATTAAACAGATGA
CACTCCATGGATTTGGGGATATTTTCCAGCTAGAATGGATCCAGAATTGAATGGTGCTTAAATTGAGAAATAATAAATAT
ATCTATATAGAGTAGACATTTCCCACTATATATTAATTGAGGTTGCAGAAGGTTCTTTATATAAAACTTATTTAAAATTT
TCATATTTCATCTTTGAAAATGTCTAATTGAGAAAAATCCATGATATTTTCTGGTATGAAAGTTTGACAGTATTAATTTT
TTTATATTTTCTTAAATCATTAAACCATTTTAATATATGTTAACTACTAATAAATGGTTTATTCTTTCTAACTCCATGTA
AGCTTTTCCAATGAAGATTGTAATAACACATTTTTGTTCTCATTTTTCTACAGATAAATTTATATTTAAAAATACCAAAA
AAAAAAATCCCTATGTATACACACCACACACATACACACACACAGACACACATTCACTTATAAGAAAATTATAGAGGACC
TGTAGGGTGAGCCCAGCCACCTGCGTTTTTAGTAC
External Resources for 4931406P16Rik
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.