Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Hdgfl1 - Juvenile M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 4.0 days Treatment Type: ISH
Gene
Gene Symbol: Hdgfl1 EntrezGene ID: 15192
Gene Name: hepatoma derived growth factor-like 1
Alternate Names: 4921520N01Rik, Hdgfrp1, HRP-1, MGC118278, MGC144483, MGC144484, Pwwp1
Related data:
From the Allen Brain Atlas: Hdgfl1
Expression Info
       

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_008232 Transcript Version: 1 Transcript GI: 6680198
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080320_02_B06
Forward Primer: TCCCTTATGAGGAGTCCAAAGA Reverse Primer: GTTCCTTCCAGACCTTTGAATG

Sequence:
TCCCTTATGAGGAGTCCAAAGAGAAGTTCGGCAAGCCCAACAAGAGGCGCGGCTTCAGCGAGGGGCTGTGGGAGATCGAG
CACGACCCTATGGTTGAGGCCTCCTCTAGCCTGTGCTCAGAAGAGGATCAGAGCTACACAGAGGATCCTGGGCTAGCAGA
GGAGCCGGAACTAGGACAGGAGCTGGTGCAGGAGCTGGAGCCCGAATTCATGCCTGAGCTGGAGGCAGAACCTGAGATGC
CTGAGACCGAGTGTGAACAGGAGCCCGAGCCCCAGCCTGCCTATGACCTGCTGGACGCCGTGGAGGAGCCGGGCCTCACC
AAGGCCGAGCCAGGAGATCAGCAAGCCGAGCATGTGCAAGAGAAGCACCCTGAGGTGGAGGCAGAGGCTGAGGCTGAGGC
TGAGGCCGAGGCAGAGGCGGAGGCGGAGGCCAAGGCTGAGGTGGAGGAGCCGGGGAGTCTGAAGAGGAGCGCGGAGGATG
AAGAGCCTCATTGTCCTCTCAAACGGCCCAGGGAGGCGGCTCCTGGTGCGTTGGAGATGGAGCCTGCTGAAGAGCGCGAG
GCTGAGGCCTCCCCCTTCGTGGAGGAGCCTGACCAAGCCCAGGAGCAGCTGCCTCCGTTGGAGGAAGAGGCCACAGAAAA
GGCGGTCCAGGGCCTGATTGTTGGAGAAATAGAAGGCCTGTAGTCACGGTGTTTGTAGAAGAGCCCCTTTTACCCGTTCC
TGCTGCCACCTGGCTGTGGCTTGGGAAACCCACTAGGGCCCAGTCTTCAACCCAGTCCACCTCTCCTTCATTCATTCGCC
TTCTACAAGCCTAAATTCCTGGCATGAGGGGACAGGCCAGTTGACATCAACTTTGTGGCTTAAGTAGTGACCACCCTTCC
CACCCTAAACTCTTAGGGGCATTTTGGACCTCTGCCTAGGAACCAGGAGTGAAGAGGGATGGAAGATGAAGAGCAGGGAC
AACATTCAAAGGTCTGGAAGGAA
External Resources for Hdgfl1
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.