Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Casc4 - Juvenile M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 4.0 days Treatment Type: ISH
Gene
Gene Symbol: Casc4 EntrezGene ID: 319996
Gene Name: cancer susceptibility candidate 4
Alternate Names: D130060C09Rik, VGFG2573
Related data:
From the Allen Brain Atlas: Casc4
Expression Info
       

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_177054 Transcript Version: 3 Transcript GI: 39930596
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080402_03_G04
Forward Primer: AATGGGGATGATGGTAACGTAG Reverse Primer: CTACGGGGGAACAAAAATGTAG

Sequence:
AATGGGGATGATGGTAACGTAGGTGAGTATGAGGCAGACAAGCAGGCTGAGCTGGCTTACAATGAGGAAGAAGATGGTGA
TGGTGGAGAGGAAGACGTCCAAGATGATGAAGAACGAGAGCTTCAGATGGATCCTGCAGACTATGGCAAACAGCGCTTCA
GTGATGTCCTTTAAGTCTAAGGGATTCCCGAAACCCAAAGTGCTGTGCAACAGATCATCTCTACTTGTCAATTTTGACTT
TTGCTGTAAAGATCAGTTGTATCAGTTGTAAAGATACATTGAGATAGATTTAAGGAAATTTTAATGAAGGAATGTACCAA
TGTACATATGTGAACTTTTTCATATTATATTATCAAAGCAGATACTTTTTTTGGTTACTACACAGCTGGGCCAAAAACAG
TTAATCTTTGCATTTTAAAGCAAACTAATGTAAATTTCACATTTTATTGAGCCTAATTTTTTTTTCACAAAGAGACAAAC
AGGAACAAATGGTTGTACAGGTTATATGCTGCACATAGTATAACCACAATGAGAACTTATTCGGCAGGTTATATGCTGCA
CATAGTATAACCACAATGAGAACTTATTCGGCTGAAAAGTCCACATTACTACATTTTTGTTCCCCCGTA
External Resources for Casc4
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.