Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Epha10 - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Epha10 EntrezGene ID: 230735
Gene Name: Eph receptor A10
Alternate Names: A330090H18
Related data:
From the Allen Brain Atlas: Epha10
Expression Info
       

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_177671 Transcript Version: 2 Transcript GI: 31343639
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080402_03_A10
Forward Primer: GACTGCAGTAGCATACCAGGTG Reverse Primer: GCCCATGGCTTCTCTACTTCTA

Sequence:
GACTGCAGTAGCATACCAGGTGCCACGGGCACCTGCAAAGAGACCTTCAACGCATACTACCTAGAAACCGAGACCGACCT
GGGCCGAGGGCGTCCCCGCCTAGGAGGCAACCGACCCCGCAAGATTGACACCATCTCAGCTGATGAGAGCTTCACGCAGG
GTGACCTGGGGGAGCGAAAGATGAAGCTGAACACAGAGGTGCGTGAGATCGGCCCCCTCAGCCGGCAAGGCTTCCACCTG
GCCTTCCAGGACGTGGGTGCGTGCGTGGCGTTGGTCTCGGTGCGTGTCTACTACAAGCAGTGCCGCGCCACAGTGCGGGG
CCTGGCAGCCTTCCCCGCCACCGCAGCTGAGAGCGCCTTCTCCACGCTGGTGGAAGTGGCTGGAACGTGCGTGGCCCACT
CGGAAGGGGAGCCCAGCAGCCCTCCCCGCATGCACTGTGGTGCCGATGGCGAGTGGCTGGTGCCTGTGGGCCGTTGCAGC
TGCAGTGCAGGATTCCAGGAACATGGTGACATCTGTGAAGGTATCCAGGGCCCCAGAGGGATGGGATAGGGACATATCGT
GCAGATGGCAGGATAGAGCGTGCTCTGGGTGAAGAGGCAGGAGTAGAAGTAGAGAAGCCATGGG
External Resources for Epha10
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.