Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Pik3cd - Juvenile M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 4.0 days Treatment Type: ISH
Gene
Gene Symbol: Pik3cd EntrezGene ID: 18707
Gene Name: phosphatidylinositol 3-kinase catalytic delta polypeptide
Alternate Names: 2410099E07Rik, AW545373, p110delta
Related data:
From the Allen Brain Atlas: Pik3cd
Expression Info
           

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_008840 Transcript Version: 1 Transcript GI: 6679318
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080402_04_C09
Forward Primer: GAGTTCGATATCAGCGTCTGTG Reverse Primer: GGGAACTCACCTTCACAAAGTC

Sequence:
GAGTTCGATATCAGCGTCTGTGACCTCCCGCGCATGGCTCGACTCTGTTTTGCTCTCTATGCCGTCGTGGAGAAGGCTAA
GAAGGCACGCTCCACAAAGAAGAAGTCTAAGAAGGCGGACTGCCCCATCGCTTGGGCCAACCTCATGCTATTCGACTACA
AAGATCAGCTCAAGACGGGGGAGCGCTGCCTCTACATGTGGCCCTCTGTCCCAGATGAGAAGGGAGAGCTGCTGAATCCT
GCGGGTACAGTGCGCGGGAACCCCAACACGGAGAGTGCCGCTGCCCTGGTCATCTACCTGCCTGAGGTGGCCCCCCACCC
TGTGTACTTCCCCGCTCTGGAGAAGATCCTGGAGCTGGGGCGTCACGGGGAGCGTGGGCGCATCACGGAGGAGGAGCTGC
AGCTGCGGGAGATCCTGGAACGGCGGGGATCCGGGGAACTGTACGAACATGAGAAGGACCTGGTGTGGAAGATGCGCCAC
GAAGTCCAGGAGCATTTCCCAGAGGCGCTGGCCCGCCTGCTGCTGGTCACCAAGTGGAATAAACACGAGGATGTGGCCCA
GATGCTCTATTTGCTGTGCTCCTGGCCCGAGCTGCCTGTGCTGAGCGCCCTGGAACTTCTGGACTCTAGCTTTCCCGACT
GCTACGTGGGCTCCTTCGCCATCAAGTCCCTTCGGAAGCTGACGGACGATGAGCTCTTCCAGTACCTTCTGCAGCTGGTG
CAAGTGCTCAAATATGAGTCCTACCTGGACTGCGAGCTGACCAAATTCTTGCTGGGCCGAGCCCTGGCTAACCGCAAGAT
CGGACACTTCCTGTTCTGGCACCTCCACTCTGAGATGCACGTACCATCAGTGGCTCTGCGGTTTGGTCTCATCATGGAAG
CCTACTGCAGAGGCAGCACCCACCACATGAAGGTGCTGATGAAGCAGGGGGAAGCACTGAGCAAGCTTAAGGCACTGAAT
GACTTTGTGAAGGTGAGTTCC
External Resources for Pik3cd
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.