Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Gm603 - Juvenile M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 4.0 days Treatment Type: ISH
Gene
Gene Symbol: Gm603 EntrezGene ID: 239731
Gene Name: gene model 603, (NCBI)
Alternate Names: Gm1759, LOC239731, mKIAA1666
Related data:
From the Allen Brain Atlas: Gm603
Expression Info
       

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: XM_155825 Transcript Version: 3 Transcript GI: 28494285
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080609_02_G09
Forward Primer: CAGGAGAGAAAGTGAAATGGCT Reverse Primer: GGCTTTATTCTTGTAGTGCTGC

Sequence:
CAGGAGAGAAAGTGAAATGGCTCAAGGTGAAGCACGCAGAGCTGACCGATCTCGCTCAGCGCCTTGAAGACAGGGCCCGC
AAGCTTCAGGAGACCAATCTGAGGGCCATGAGTGCTCCAGTGCCAGGTGAGAGCCTCGAAGGTCTGGACCTGAGCCAAGT
GTTTACCTGCCAGCGTGCTCAGGACCTGTCAGAACAGGCTGGCGCGCTGCAAGCCAAGGATCTACAGATCGAAGCATTGA
GGCGGGAGTGCCACCTGCTGCAGGCGCGCATCGCCGCGGACCTTGGCAGCTCCTCGCATCCTGAAGAGGGCGCCACGTGC
GCGCAATGGTGCAACATCAGTGACTTGGACCGGCTGCAGCGTGAGTCTCAGCGGGAAGTGCTGCGCCTGCAAAGACAGTT
GACTCTACATCAGAGTAAAGCAGGCGCCTGGGCAGACGCGGGCAGACCCAGCACACCCTCGGAGATAACTCGGCACCAGG
TGCAGGCGCTGGAACGCGAGTTGGGTTTACAGCGGCGGGAATGCGAGGAACTGAGCGTTCAGGCAGCCGCAGCTGAGCGG
CGCTACGAGGAGACAGAGGCACAACTGCAGGCCGCGCTGCACAAAGGCGCCAGGCTGTCAGAGGAGAATGCACGGCTGCA
GGCCCTGGCCAACTGGATGAAGAAGATGGCAGATGAGAACAGCAATGTTTCCCGGCAGCAAAGTCACACGAGGCAGAGGC
AGGAACTCGAAGCCACTAGCCTGCTGGCTGAGCAGCTGCTGCAACAAGAGGGATATGCGCAAGACAGGCGGCAGCAGCTG
CAGCACTACAAGAATAAAGC
External Resources for Gm603
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.