Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Mm.336576 - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Mm.336576 EntrezGene ID:
Gene Name: Unigene Mm.336576
Alternate Names:
Related data:
Expression Info
         

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: Mm.336576 Transcript Version: 0 Transcript GI: -3237
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080618_03_D10
Forward Primer: GCATCCAGAATAGGAAAGATGG Reverse Primer: CATCATTGTCTGGAGAGCTGAG

Sequence:
GCATCCAGAATAGGAAAGATGGAAATTTGCCTGGGTTTAATTTAGAGGTCTGCAAAGTCTAAAAATGGATTATCAAGGCA
GTGCCCTTTACATAGAGTATGAACCAAAATGTATTGGTTGCTACCTTATGCTCACCTGAATTAACTTTAGATTTACGGGT
GCAGGGTTGGTTTTGCACAATTGTTAACAGTAGAAAAGAAAATGACATTTTGAGTTACCAAGTTACTATATCAAGTTAAC
AGAGCAGTTTCATATAGTACACCTTTATGTTTCCAAAATTGGATATAATAAATTGGGATGCTATAAAGAAGTGACTATTT
TAGAAATGACATCATGCTATTTTCTAGTATGTATCGCAAATGATGTGATTATTTTTCTTTTTAATATTTCCTCATGTTTA
TGAAACACTTTATTTTTTAAAAGATGTTTGAATTGTGTCTTAATCCTTCAGTGTTTAACTTTCTTCATTTGCAACAGTGT
TGGCACCGTGGTGATGGGAGGCCTCTGCCTGTGAGGACAGCTAAGGCTGGGTTATGATACTTTGTATTTTAAATGTTTCA
TTAACTCAGCTCTCCAGACAATGAT
External Resources for Mm.336576
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.