Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Mrpl43 - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Mrpl43 EntrezGene ID: 94067
Gene Name: mitochondrial ribosomal protein L43
Alternate Names: 4930442D21Rik, bMRP36a
Related data:
From the Allen Brain Atlas: Mrpl43
Expression Info
   

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_053164 Transcript Version: 2 Transcript GI: 28872810
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080623_01_A12
Forward Primer: CTCTCTAACCGTAGCCATGACC Reverse Primer: GACAGCCTCCAGACTCTTTCAT

Sequence:
CTCTCTAACCGTAGCCATGACCGGTCGCGGGACTTCGAGCCGCTTTCTGACCAGCGTCCTCCATAATGGGCTAGGGCGTT
ACGTGCAGCAGCTGCAGCGCCTCAGCCTCAGCCTCAGCCGGGATGCGCCCTCGTCCCGCGGCGCCAGGGAGTTCGTGGAA
CGCGAGGTGACCGACTTCGCCCGACGGAACCCAGGAGTCGTAGTATACGTGAACCCGCGCCCGTGCGCCATGCCACGAAT
AGTGGCCGAATACCTTAATGGGGCTGTGCGCGAGGAAAACGTCAACAGCAAGTCGGTGGAGGAGATCAAGTCGTTGGTGC
AGAAGCTGGCAGACCAGTCCGGCTTGGATGTGATCCGCATCCGCAAGCCCTTCCACACGGACAACCCGAGCATCCAGGGC
CAGTGGCACCCCTTCACCAACAAACGGACTGCCCTCCACGGGCTGCGGCCCAGAGAACTCCGGGATTCTGCTCCAGCTTC
GATGCAAGCACAGTAAAGAACCAGGCGCTTTGGACCGTGAGAGGGATAGGATTGGTTCCTCTTTTGGATTTCAAGCTCAG
GCCGAGTAGGTGGGTGGAGCCTACCAGCCGGGGCGTGGCCTGAGATAAAGAAGAACCTTTTCCTTTGCCCACTTGTAGCT
AGGTGCAGTGACCTTGTGAATACCCTAATTCTGATTCAATTGGCCTCCTTGCAAGCTGAGATGTGAGAAGTGTACAACAC
TTGTACAAGGACCGTGTTTTCTGAAATACGAATAATAATGACTTCAAAACACATGAAAGAGTCTGGAGGCTGT
External Resources for Mrpl43
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.