Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Csf2 - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Csf2 EntrezGene ID: 12981
Gene Name: colony stimulating factor 2 (granulocyte-macrophage)
Alternate Names: Csfgm, Gm-CSf, MGC151255, MGC151257, MGI-IGM
Related data:
From the Allen Brain Atlas: Csf2
Expression Info
         

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_009969 Transcript Version: 2 Transcript GI: 24475603
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080630_04_D04
Forward Primer: GACTGATATCCCCTTTGAATGC Reverse Primer: ATATCTCTCGTTTGTCTTCCGC

Sequence:
GACTGATATCCCCTTTGAATGCAAAAAACCAGTCCAAAAATGAGGAAGCCCAGGCCAGCTCTGAATCCAGCTTCTCAGAC
TGCTGCTTTTGTGCCTGCGTAATGAGCCAGGAACTCGGAATTTCTGCCTTAAAGGGACCAAGAGATGTGGCACAGCCACA
GTTGGAGGGCAGTATAGCCCTCTGAAAACGCTGACTCAGCTTGGACAGCGGAAGACAAACGAGAGATA
External Resources for Csf2
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.