Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Lsm14b - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Lsm14b EntrezGene ID: 241846
Gene Name: LSM14 homolog B (SCD6, S. cerevisiae)
Alternate Names: 9430078B04, BC040823
Related data:
From the Allen Brain Atlas: Lsm14b
Expression Info

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_177727 Transcript Version: 2 Transcript GI: 31343196
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080630_03_G02
Forward Primer: GCCACATGGTGCTGTATAGGTA Reverse Primer: TATCCTTGATATCACTTCCCCG

Sequence:
GCCACATGGTGCTGTATAGGTATTGTCAGCGAGCTCGAGTAGCTGTTAGTTGTGAAGAGAGTGCTGTGTCAGAGGGCACT
CTCTGTAGTCAGAAGCTTGGCCCAGGACAACAAGTTAACTGTCGTTTTCTCAACCCCTAAGTGAGGTCCTTTGGTACTGA
AGACCGTCCCACAGACAGGCCTGCTCCCCCAAGAGAGGAAATTTATGAGTACATCATTTTCCGGGGAAGTGATATCAAGG
AT
External Resources for Lsm14b
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.