Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Bckdha - Juvenile M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 4.0 days Treatment Type: ISH
Gene
Gene Symbol: Bckdha EntrezGene ID: 12039
Gene Name: branched chain ketoacid dehydrogenase E1, alpha polypeptide
Alternate Names:
Related data:
From the Allen Brain Atlas: Bckdha
Expression Info
 

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_007533 Transcript Version: 2 Transcript GI: 31982493
Riboprobe
Orientation: Antisense Riboprobe ID: RP_071212_02_E07
Forward Primer: CTGCAAGGAACGCCACTT Reverse Primer: GGGAGTGAAGTAGCCGCA

Sequence:
CTGCAAGGAACGCCACTTCGTCACCATTTCCTCTCCACTGGCCACGCAGATCCCTCAGGCGGTAGGGGCAGCCTATGCTG
CCAAGCGGGCCAATGCCAACCGGATTGTGATCTGTTACTTTGGCGAGGGGGCAGCCAGTGAAGGGGATGCCCACGCCGGT
TTCAATTTCGCTGCCACCCTGGAGTGTCCCATCATCTTCTTCTGCCGGAACAATGGCTATGCCATCTCCACACCAACCTC
TGAGCAGTACCGTGGGGATGGCATAGCGGCTCGGGGCCCTGGGTACGGCATCATGTCAATCCGTGTGGACGGCAACGATG
TGTTTGCTGTGTACAATGCCACTAAGGAGGCCCGACGGCGGGCTGTGGCTGAGAACCAGCCCTTCCTCATTGAGGCCATG
ACCTACAGGATTGGCCACCACAGCACCAGTGACGACAGCTCAGCGTACCGTTCGGTGGACGAGGTCAATTACTGGGACAA
GCAGGACCACCCAATCTCGAGGCTGAGGCAGTACCTGCTGAACCAGGGTTGGTGGGATGAGGAACAGGAGAAGGCCTGGC
GGAAGCAGTCACGAAAGAAGGTCATGGAAGCCTTTGAGCAGGCTGAGCGGAAGCTAAAGCCGAACCCAAGCCTCCTCTTC
TCCGATGTGTACCAGGAGATGCCCGCCCAGCTCCGCAGGCAGCAGGAGTCGCTGGCACGGCACCTGCAGACTTACGGGGA
GCACTACCCCCTGGACCACTTTGACAAGTGAGGCCCTAGCCAGCACGAGGGGGTCCTGCTCTGAGTGGATGCTGCCCCCT
GTGCTGGTCAGCTGTGCGAACATGCTGAGCAGCCAGGGTGGCATTCCAGGGTGACTTTTGCTCCTGTTCCTGCTCCCCCA
GGCTACTTCACTGGGGCACCATGTTTGCAGCCGTTGCTGCGGCTACTTCACTCC
External Resources for Bckdha
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.