Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Plp2 - Juvenile M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 4.0 days Treatment Type: ISH
Gene
Gene Symbol: Plp2 EntrezGene ID: 18824
Gene Name: proteolipid protein 2
Alternate Names: MGC102445, MGC103126, mIMA4
Related data:
From the Allen Brain Atlas: Plp2
Expression Info
   

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_019755 Transcript Version: 2 Transcript GI: 31980963
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080317_03_H02
Forward Primer: ATACTGTGCCTGGTGATCTTGA Reverse Primer: TGGTTCAAGCAGAACTGATGTC

Sequence:
ATACTGTGCCTGGTGATCTTGATTTGCTTCAGTGCATCTACAACATCGGCCTACTCCTCCCTGTCGGTGATTGAGATGAT
CTGTGCTGCTGTCTTACTTGTCTTCTACACGTGTGACCTGCACTCCAAGATATCATTCATCAACTGGCCTTGGACTGACT
TCTTCAGATCCCTCATAGCAACCATCCTGTACCTGATCACCTCCATTGTTGTCCTTGTAGAAGGAAGAGGCAGCTCCAGA
GTTGTCGCTGGGATACTGGGCTTACTTGCTACGTTGCTCTTTGGCTACGATGCATACATCACCTTCCCTCTAAAGCAGCA
AAGACATACAGCAGCTCCCACTGACCCCACTGATGGCCCGTGATCGTCTTTCAGCTGTCTCTGCTACCTGTCAATAGCTC
CTCCATCAAAAACTTTCCTCCTGTCGGGCGGTGGTGGTGCTCGCCTTTCCTCCAAGCTCTCAGGAGGCAGAGGCAGGTGG
ATCCCTGTGAGTTTGAGGCCAGGGCTACACAGTGAGATCCTGTCTCTAAAACAATTCCTTCTCCGGTTTCCACAACACTC
CAGCCAATTCTCTGACCCCATTGAAAGTGCTTATGGTACAAGAGATTGAACCTAGAGCCGTGTGCATACTAGGCAAGTAT
TCTCCACTGAGCTACATCCCTGTAAAAGTGCCTTTATTGGGAGTTTTGTCTTCCAGCCTGCCAATCAACCCATCTGGGTG
TGGCCACCTTTATGGGTGTGCCTAGATTCCCCTTTGCTCTGCAGTACCAGCAGCCGACATCAGTTCTGCTTGAACC
External Resources for Plp2
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.