Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Camk1g - Juvenile M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 4.0 days Treatment Type: ISH
Gene
Gene Symbol: Camk1g EntrezGene ID: 215303
Gene Name: calcium/calmodulin-dependent protein kinase I gamma
Alternate Names: CLICK-III, MGC30513
Related data:
From the Allen Brain Atlas: Camk1g
Expression Info
         

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_144817 Transcript Version: 1 Transcript GI: 21450190
Riboprobe
Orientation: Antisense Riboprobe ID: RP_071219_04_F08
Forward Primer: GTGGCCGCTCACTCAACT Reverse Primer: TGCTGTGAGATGGAGGCA

Sequence:
GTGGCCGCTCACTCAACTGCCTGGTCAACGGCTCCCTGCGCATCAGCAGTAGCCTAGTGCCCATGCAACAGGGCCCCCTA
GCCACGGGGCCCTGTGGCTGCTGCTCCAGCTGTCTAAATATTGGGAACAAGGGAAAGTCTTCCTACTGCTCTGAGCCTAC
CCTCTTCAGAAAGGCCAATAAAAAACAGAACTTCAAGTCAGAGGTCATGGTACCAGTGAAGGCTGGTGGCAGCACCCACT
GCCGGGGTGGGCAGACTGGGGTGTGTCTCGTTATGTGATCCCAGGAGCCCATGTGGTTTTCAGGAGACATTCCTGGCTCT
TCTCTGCCTCTCTGAGCTGGCATCTGCCCTGAGGAAGGGGGGCAGTGGAATAGAGATAGCCAAAGCAGCTGGTCTGAGGC
AGTAGGGCTGTTGCTGCCTGGGCAGACACTCACAGGAAGTCCAGAGGAGCCAGCCCCAATCTTGGACGTTCTCTGAGGCC
ACAAGCAGGATGAGTGGCCTGCCTGCCTCCAGCATCCCAGCCTCCAGGTCTCCCGACCTGCCCATTCCCTTCCCCACATC
ATACGTGCAGTGGCTCCATGCAGTGTCCATAGATAGTGCTCATCTGGGTCCGTGTTGTTTGTTGTGAAAAGCTTTATGGG
CTGGCCAGGCTGTGTCACTTTCTTCAAGCAAAGCCATATGGAGTCTAACTCAGACTCCCTGCTCTGCAGACTCGCTCCTG
CCTATCTGGCCTCACGGCCAGACTGGACCCATTATCATAGTACCTGCCTATTCGCATGAATGCCAGGCTGCACCAGGGGC
CTGGGAGCACTCACAACTCCAGTCCGTTCCTCCAGGATTAGCTTCCCACTGCACGGAGACCCAGGCCACTCCAAAGCTCT
CCTTGCCTCCATCTCACAGC
External Resources for Camk1g
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.