Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - Hnrpul2 - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: Hnrpul2 EntrezGene ID: 68693
Gene Name: heterogeneous nuclear ribonucleoprotein U-like 2
Alternate Names: 1110031M08Rik, AI465155
Related data:
From the Allen Brain Atlas: Hnrpul2
Expression Info
         

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: XM_355145 Transcript Version: 2 Transcript GI: 51771419
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080228_02_A03
Forward Primer: CTTCCCTTCAAGTCCTCAGAGA Reverse Primer: GGGCTCCAGTTTCTATCTTCCT

Sequence:
CTTCCCTTCAAGTCCTCAGAGAGGCCTCTTATCAAGAGACTTCATTTGGGATCATATAGTTTGTAACTTTAACAACACCC
TCCCAGTTCTTGACAGAATAGCTACAGGTTGCTGGGTTCAAGAATGTGAGCAGGATATAGCAATGCGCTTTCAATATTGA
TCTTCAATTTAAATCATCATCTTGCTTAGCTAAAAGCTTACTCAGCAACAGCATCCTACAACACTTCCTGGTGAGAAAAT
CTCTGGGCTGAGTTACTAGGACATACTTCACTTCCACTTCCTTGCCTGAGCAGTTCTCTTGTTTAAACTTGTGCTGAGAT
TTGAATCTTCCCTGTCCTGATGTCCTTCCCACGCAGGCAAGGCTTCTCAGGGTGTGCAGACCTCATTCTGAGTCCTGGTT
TGTTAGGACACACCGTTCTGCTCAAGGACCTCTTTCCAAGGCTGCAGTGGGCCTGGGAGGAGAGAAGCGTGCTCATACTG
TGTCTTTTCTATTGCACTTGTCCCTATGGTGCCACAGATGGGTTTGTGTGTGGCAGTGGGTGGAATGATTGCATGCATCT
TTTGTAACTCGCTGGTATTAGAAAGGGAGTTCAAGAAAGCATTGTTTATAATGTCAGGGCAGGAAGATAGAAACTGGAGC
C
External Resources for Hnrpul2
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.