Gene Search Advanced Search Reference Atlas Documentation Help Settings About
Image Series Detail - B430203M17Rik - Adult M
View all associated images
Specimen
Strain: C57BL/6J Sex: M Age: 56.0 days Treatment Type: ISH
Gene
Gene Symbol: B430203M17Rik EntrezGene ID: 320193
Gene Name: RIKEN cDNA B430203M17 gene
Alternate Names:
Related data:
Expression Info

From rostral to caudal, each section is labeled [image index]-[tissue index]-[structure abbreviation].
C - Cervical, T - Thoracic, L - Lumbar, S - Sacral, Co - Coccygeal.
Expression Categories
Transcript
NCBI Accession: NM_177096 Transcript Version: 2 Transcript GI: 31342796
Riboprobe
Orientation: Antisense Riboprobe ID: RP_080310_01_D10
Forward Primer: GAGCTCTTAACCACTGAGCCAT Reverse Primer: GGGTCTCATTATGTACCCCAGA

Sequence:
GAGCTCTTAACCACTGAGCCATTTCTCCAGCCCACATCTACCTCTTTTTTGAAACAAATACTTTTGCTAGTGAGTGGAAT
CCTCTTACAAATTCATATATCTGAATTGAAGAATAGGCCCAACACCCCAAACCACAAAACTGTCATTATAGCTTCTAAAG
AAAATCCAGGTGAGGAAAGAGTGTTGGCCAGAAATGATCTGTGTCACTTTTGTCACAGAGATTCTGTAAGTTACCATAGA
ACTCGAAGCATTATGTATTCCAAACTTCAGAGGTTCTTCATAAAGGGGAAAAACTGAATTAAGAGAAGTTATGGCTTCAT
TCAGATCGCATAGCATTCCTGTTTTCAGGTCACCTGAGTCAGATTCATTTAGGTCCTGTACTGCATTTGAGCAAGATAAA
CATGTATAGTCCTACTTGTTTCTTATTAAAGTAGAGGCAGCAGGGCTGGCCTCAGTGTGCGTGGGACCCAGCAGTTGGCA
GGTAGAGTTAGGAGGATCAAGAGTCAAAGCCACCATCAGATCCTGCAGTGTGTTTGAGGCCAGCTCTCCCCTGGGGGGAA
ATTGAGGTTGTAATGGTTGGCTGTGGTGTCACAGAGGCCTATAATCTCCACTGTTGGAGCCTGAAGCAATAGAATACCTA
TTTTGAGACCATTCTGGGGTACATAATGAGACC
External Resources for B430203M17Rik
NCBI Entrez Gene Unigene GNF SymAtlas
GenePaint KEGG AmiGO
This data is also available as XML.